Detection of blaNDM-1gene for the production of MBL in Clinical Strains of Klebsiella pneumoniae
1BDS Student, Saveetha Dental College, Chennai.
2Senior Lecturer, Department of Microbiology, Saveetha Dental College, Chennai.
Corresponding Author E-mail:
ABSTRACT:
Spreading of NDM-1 producing K. pneumoniae in a clinical setting is a complex event involving several modes of spread, such as dissemination of several unrelated strains or the propagation of a single clone from patient to patient and from the environment to patients. A total of 20 clinical isolates of K. pneumoniae were subjected to antibiotic susceptibility pattern followed by the detection of blaNDM-1 gene by PCR. Our results indicates the increased degree of resistance to most of the routinely used antibiotics. 10% of our isolates were found to posses this gene among our isolates. Early detection of these genes will help in prevention and adequate infection control by limiting the spread of these organisms.
KEYWORDS : Klebsiella pneumoniae, blaNDM-1, Carbapenems, PCR.
INTRODUCTION
Klebsiella pneumoniae is one of the most encountered pathogen of Enterobacteriaceae family responsible for various nosocomial infections, especially in intensive care units (ICU) and in neonates.[1] Carbapenems are the beta-lactam antibiotics which bind to the bacterial penicillin-binding proteins which results in the elongation and cross linking of peptidoglycan of the bacterial cell wall leads to impaired cell wall synthesis and cell death. Incidence of multi drug resistance in organisms is increasing due to spread of resistance determinant genes mediated by transposons, plasmids and gene cassettes in integrons. However, due to the presence of extended-spectrum beta-lactamase and AmpC enzymes in these Gram-negative bacilli, carbapenems have become the drug of choice to treat such infections.
Carbapenems, most commonly meropenem and imipenem (IP), have been considered as most promising beta-lactams against multi drug resistant Gram-negative bacteria. However, the increased use of carbapenems has led to the emergence of resistant strains and outbreaks due to these are mostly associated with significant morbidity and mortality. Due to production of carbape-nemases in clinical isolates of Entero-bacteriaceae, the treatment of ICU patients is becoming difficult.
Resistance to carbapenems due to carbapene-mase production poses serious challenges in the treatment of such infections with resistant strains.[2] Mobile genetic elements are being associated with carbapenemases production. The genetic trait of blaNDM-1 likely facilitates the rapid dissemination of this gene within K. pneumoniae isolates. Spreading of NDM-1 producing K. pneumoniae in a clinical setting is a complex event involving several modes of spread, such as dissemination of several unrelated strains or the propagation of a single clone from patient to patient and from the environment to patients. With this background, our study was undertaken to detect the blaNDM-1 gene in clinical isolates of K. pneumonia.
MATERIALS AND METHOD:
Bacterial Isolates:
A total of 20 non repetitive urinary isolates of Klebsiella pneumoniae were collected from Saveetha Medical College and Hospitals, Chennai. They were processed for a battery of standard biochemical tests and confirmed. Isolates were preserved in semisolid trypti case soy broth stock and were stored at 4 ºC until further use.
Antibiotic Susceptibility Testing:
Antibiotic sensitivity test was carried out by Kirby Bauer disk diffusion method with routinely used commercially available antibiotics (HiMedia, Mumbai). These antibiotics include Ampicillin, Amoxycillin, Ceftazidime, Cefotaxime, Amikacin, Gentamicin, Imipenem, Ciprofloxacinas per CLSI 2015 guidelines.[3]
Detection of blaNDM-1 gene in K. Pneumoniae:
Klebsiella pneumoniae isolates were detected for the presence of blaNDM-1 gene by PCR analysis. Detection of the gene was carried out using primer as depicted in table 2. Bacterial DNA was extracted by boiling lysis method. 1 µL of DNA extract was used as template for PCR reaction. The reaction mixture contained 1mM of Mgcl20.2mM dNTP mix and 0.8µM of blaNDM-1 gene with 1U of Taq polymerase (New England Biolabs) in a 1x PCR buffered reaction. A positive control of K. pneumoniae with blaNDM-1 gene was also included in this study. PCR amplification was carried out using thermal cycler (Eppendorf) with the following cycling condition. Initial denaturation at 96°C for 3 minutes, 30 cycles of denaturation at 95°C for 1 minute, primer annealing at 54°C for 40 seconds and primer extension at 75°C for 1 minute and final extension at 72°C for 5 minutes were used. PCR products were resolved in 1.5% agarose gel. A 100bp ladder was including in all the gel analysis.[4]
Table 1: Gene sequencing of blaNDM-1 gene
|
Primer |
Primer sequence |
Product size |
|
blaNDM-1 |
CACTTCCTATCTCGACATGC GGGCCGTATGAGTGATTG |
621 bp |
RESULT:
Sample Wise Distribution of Clinical Isolates of Klebsiella pneumoniae: Of the 20 clinical isolates of Klebsiella pneumoniae, 12/20(60%) were from urine, 4/20(20%) from stool, 3/20(15%) and 1/20(5%) were from the wound swab and pus respectively.
Antibiotic Susceptibility Testing
Increased percentage of isolates were showing resistance to cephalosporins and other group of antibiotic(80-100%). We found very less number of isolates were sensitive to imipenem (20%) which is considered to be a most potential drugs The detailed resistant pattern of Klebsiella isolates were showed in table 1.
Table 1: Results of antibiotic susceptibility patterns of Klebsiella pneumoniae:
|
Antibiotics |
Sensitivity (%) |
Intermediate (%) |
Resistant (%) |
|
Ampicillin |
5 |
0 |
95 |
|
Amoxicillin |
5 |
0 |
95 |
|
Ceftazidime |
5 |
0 |
95 |
|
Cefotaxime |
0 |
0 |
100 |
|
Amikacin |
0 |
0 |
100 |
|
Gentamicin |
15 |
5 |
80 |
|
Imipenem |
20 |
0 |
80 |
|
Ciprofloxacin |
0 |
0 |
100 |
Result of blaNDM-1 gene in K. pneumoniae:
L1
L2 L3 L4 L5 L6 L7
2/20 (10%) clinical isolates of K.
pneumoniae were found to harbor blaNDM-1 gene.
L2-100bp ladder; L6, L7-621bp blaNDM-1 gene
Figure 2: Representative gel picture showing positive for blaNDM-1 gene
DISCUSSION:
The result of our study showed that, most of these isolates were resistant to multiple antibiotics tested, however only 30% of isolates were resistant to imipenem. Increased percentage of resistance was observed in cephalosporin group of antibiotics. They were subjected for the presence of blaNDM-1 gene by PCR. It showed only 2/20 (10%) strain was found to harbor blaNDM-1 . blaNDM-1 is a transferable class B MBL gene. Since its 1st appearance in 2008, it has been identified in different Gram-negative isolates from different parts of the world including UK, Pakistan, Australia and USA, mostly from patients who are epidemiologically linked to the Indian subcontinent.[5] Several reports from India have shown there is 5-8% prevalence of blaNDM-1 ,, a finding that is somewhat similar to our study findings.[6]Since all the NDM-1 possessing isolates exhibited high-level of resistance to a different generation cephalosporins, it is understood that it may have other genes for multiple antibiotic resistance. Study conducted by Bora and coworkers in 2013 adopted PCR detection for some of the important types of ESBL genes as well as AmpC gene. As expected, each of the blaNDM-1 positive isolate harbored two or more additional bla genes. [7] Of these, blaCTX-M was the most common and found in all isolates, whereas blaTEM was found in 78.57% (11/14) isolates. Only 21.43% (3/14) of NDM-1 producing isolates was positive for plasmid-mediated blaAmpC. However, in our study we did not detect for these genes. Earlier studies from India[8] and abroad,[9] also reported the co-existence of different types of ESBL genes (mostly, blaTEM-1 and blaCTX-M-15) along with AmpC genes (mostly, blaCMY) in blaNDM-1 positive E. coli isolates. The presence ESBL and AmpC genes in the blaNDM-1 positive isolates might contribute to the high level of resistance.
CONCLUSION:
Transmission of plasmid carrying these resistant genes to other members of Enterobacteriaceae will increase the incidence of multidrug resistance. Early detection of these genes will help in prevention and adequate infection control by limiting the spread of these organisms.
ACKNOWLEDGEMENT:
I sincerely thank Dr. Kalyani, professor and head, Department of Microbiology, Saveetha Medical college, Chennai, for kindly providing the clinical isolates to carry out our research work fruitfully.
REFERENCES:
1. PodschunR, Ullmann U. Klebsiella spp. as nosocomial, pathogens: Epidemiology, taxonomy, typing methods, and pathogenicity factors. ClinMicrobiol Rev 1998:1;1589-603.
2. Livermore DM, Woodford N. The beta-lactamase threat in Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends Microbiol 2006:14;413-20.
3. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk Tests; Approved Standards; Document M2-A9, 9th ed., Vol 26. Wayne, PA: CLSI; 2015.
4. Bora A, Ahmed GU, Hazarika NK, Prasad KN, Shukla SK, Randhawa V, et al. Incidence of blaNDM-1 gene in Escherichia coli isolates at a tertiary care referral hospital in Northeast India. Indian J Med Microbiol 2013:31;250-
5. Nordmann P, Poirel L, Walsh TR, Livermore DM. The emerging NDM carbapenemases. Trends Microbiol 2011: 19; 588-95.
6. Deshpande P, Rodrigues C, Shetty A, Kapadia F, Hedge A, Soman R. New Delhi Metallo-beta lactamase (NDM-1) in Entero-bacteriaceae: Treatment options with carbapenems compromised. J Assoc Physicians India 2001:58;147-9
7. Bora A, Ahmed GU, Hazarika NK, Prasad KN, Shukla SK, Randhawa V, Sarma JB. Incidence of blaNDM‑1 gene in Escherichia coli isolates at a tertiary care referral hospital in Northeast India. Indian J Med Microbiol 2013: 31(3);250-256.
8. Roy S, Singh AK, Viswanathan R, Nandy RK, Basu S. Transmission of imipenem resistance determinants during the course of an outbreak of NDM-1 Escherichia coli in a sick newborn care unit. J Antimicrob Chemother 2011:66;2773-80
9. Mulvey MR, Grant JM, Plewes K, Roscoe D, Boyd DA. New Delhi metallo-β-lactamase in Klebsiella pneumoniae and Escherichia coli, Canada.Emerg Infect Dis 2011:17;103-6.
Received on 23.06.2016 Modified on 06.07.2016
Accepted on 15.07.2016 © RJPT All right reserved
Research J. Pharm. and Tech 2016; 9(10):1618-1620.
DOI: 10.5958/0974-360X.2016.00321.8